04. F13-18.pdf675.5KB

Introduction

 The genus Cymbidium in Orchidaceae comprises approximately 52 species distributed from Northwest India to China, Taiwan, Korea, and Japan. Cymbidiums have been cultivated for more than 500 years for their highly ornamental characteristics, and they remain an important group of orchids in northeast Asia (Lee 1986). Most of the commercially important cultivated cymbidiums are hybrids derived from recognized species, and many of these hybrids have several species in their ancestry (Pigors 2000). Despite the economic value of this genus, DNA markers have not been used sufficiently in cymbidium breeding. Classical approaches for the identification of cymbidium species and cultivars are mainly based on horticultural, morphological, and physiological descriptions, which often result in ambiguity (Du Puy and Cribb 1988). Recently, the use of random amplified polymorphic DNA (RAPD) techniques and DNA sequence analysis in specific genomic regions has become routine in cultivar identification and genetic diversity analysis of many plants. For analyzing genetic relationships among 48 Cymbidium cultivars, RAPD analysis was performed and reported to be efficient in assigning classifications based on genetic similarity (Park et al. 2010). In addition, RAPD analysis has been indicated to be a potential tool for assessing parental material for cross breeding among Cymbidium goeringii cultivars (Kim et al. 2011). The basis of genetic diversity is sequence variation; analysis of DNA sequence has frequently resulted in reconstructed classification schemes that often conflict with traditional taxonomy (Jobst et al. 1998).

 For assessing molecular phylogenetic relationships among plants, the nuclear genes coding for the 18S and 25S ribosomal RNA (rRNA) components have been used at the family and higher taxonomic levels (Lipscomb et al. 1998). The 18S-26S nuclear ribosomal RNA gene family has proven to be a valuable tool for phylogeny reconstruction in plants (Palacio et al. 2000). In angiosperms, the nuclear ribosomal DNA (rDNA) units, separated by a large intergenic spacer (IGS), consist of a single transcribed region containing the external transcribed spacer (ETS), the 17-18S gene, an internal transcribed spacer (ITS1), the 5.8S gene, a second internal transcribed spacer (ITS2), and the 25S gene (Rieger et al. 1991).

 Comparative sequencing studies have been extensively used in plant systematics. For example, use of the ITS region in plant molecular systematics was reviewed by Baldwin et al. (1995). The ITS region is now a widely used data source in molecular systematic studies of plants at lower taxonomic levels for 2 principal reasons: First, the high copy number allows easy amplification of the region from total extracted DNA, and second, the spacer (ITS) sequences evolve rapidly and can therefore resolve lowerlevel relationships better than slowly evolving genes, such as 18S and rbcL (Baldwin et al. 1995). The simultaneous alignment of many nucleotide sequences is now an essential tool in molecular biology; it has been used to detect homology between new sequences and existing families of sequences. Specifically, this study includes 8 newly generated rDNA sequences of cymbidiums, thus representing the use of molecular markers to investigate phylogenetic relationships among cymbidiums.

Materials and methods

Plant material and genomic DNA extraction

 The Cymbidium species used in this study were Cymbidium insigne, C. ensifolium, C. marginatum, C. faberi, C. gyokuchin, C. kanran, C. forrestii, and C. goeringii. As an outgroup comparison, Paphiopedilum insigne was included. All plant samples for DNA extraction are indicated in Table 1. Fresh leaf tissue (100 mg) was ground to a powder in liquid nitrogen, following which genomic DNA was extracted using a Wizard Genomic DNA extraction kit (Promega, USA). The DNA pellets were air-dried and then re-dissolved in 100 μL of distilled water. DNA was quantified by absorbance at 260 nm. DNA yields from cymbidium leaf samples were approximately 15- 50 μg·mg^-1 fresh weight.

ITS rDNA amplification, cloning and sequencing

 Primers [ITSF-AJ297952 (GTCCTAACAAGGTTTCCGTA); ITSR-AJ207953 (TTCTCCGCTTATTGATATGC)] were used for the entire ITS region. DNA amplification was performed in a volume of 50 μL, containing 10 ng of template DNA; 0.2 mM each of dATP, dGTP, dCTP, and dTTP; 50 pM of each primer; 20 mM Tris–Cl (pH 8.0); 100 mM KCl; 0.1 mM EDTA; 1 mM DTT; 0.5% Tween 20; 0.5% Nonidet P-40; 50% glycerol; 1 unit of Taq DNA polymerase (Takara, Japan); 5 mM MgCl₂; and distilled water. The polymerase chain reaction (PCR) consisted of an initial denaturation step at 94℃ for 5 min, followed by 35 cycles of 40 s at 94℃, 1 min at 50℃, and 1 min at 72℃. A final extension was performed at 72℃ for 10 min. PCR was performed using a thermal cycler (Bio- Rad, USA). The PCR products were purified using a High Pure PCR Product Purification Kit (Roche, USA) and were cloned into the pGEM-T Easy vector by using a T4 ligase (Promega, USA). At least 3 individual leaf samples from one species were used for PCR. The ligation mixture was transformed into Escherichia coli strain JM109 competent cells (Promega, USA). The selected recombinant clones of the ITS rDNA of the 8 cymbidium species were confirmed by EcoRI digestion. DNA sequencing was conducted using the dideoxynucleotide chain termination method at Bioneer Co. (Daejon, Korea). Sequencing was repeated from 4 to 7 times per clone per cymbidium, following which reliability was confirmed using EditSeq (Lasergene ver. 6, DNASTAR Inc., Wisconsin, USA).

Sequence alignment and phylogeny

 A consensus sequence for each species was obtained by alignment of the sequences from clones using MegAlign software (Lasergene ver. 6, DNASTAR Inc.). A consensus ITS sequence from each species was compared with previously reported ITS sequences in the database of the National Center for Biotechnology Information (National Institutes of Health, USA). DNA from the outgroup species for comparison (P. insigne) was amplified and sequenced in a similar manner. Pairwise sequence comparisons and alignments were performed using a CLUSTAL W multiple sequence alignment algorithm with a gap-opening penalty of 10, a gapextension penalty of 5, and a transition weight of 0.5. The display divergence cutoff value was 30%. The evolutionary history was inferred using the unweighted pair group method with arithmetic mean (UPGMA) for hierarchical clustering, and a phylogenetic tree was created using the maximum likelihood method as a parametric statistical method with the software Mega 5.1 (Tamura et al. 2011). Maximum parsimony (MP) analysis describing nonparametric statistical method was performed for phylogeny reconstruction using Mega 5.1. Tree inference options were made using Close-neighbor-Interchange on Random Trees using the MP search method.

Results and Discussion

 In this study, rDNA sequences were used to evaluate the genetic relationships among 8 species of cymbidiums. Amplification of ITS regions using the primer pair (ITSF and ITSR) generated PCR products from 712 bp to 762 bp in length (Fig. 1). Clones for ITS rDNA sequencing were obtained and confirmed by EcoRI digestion (data not shown). Comparison with an almost complete sequence for the 18S-25S nuclear rDNA of Arabidopsis thaliana (GenBank Accession X52320) revealed that 53 bp and 43 bp of each PCR product were derived from the 18S and 25S gene, respectively. Sequences obtained from the ITS regions between 18S and 25S rDNA in the 8 cymbidium species were analyzed and submitted to GenBank under the accession numbers indicated in Table 1. Next, the ITS sequences of the 9 species were aligned and investigated. Variation in ITS length (Table 1) was detected in parallel with nucleotide site variation. The lengths of the ITS regions for Oriental cymbidium species, except for C. insigne, varied from 643 to 655 bp. The length of the ITS region was 235 bp for ITS1, 153–165 bp for 5.8S, and 255 bp for ITS2. Most of the length variation encountered was due to nucleotide insertion/deletion events, including some serial deletions. Serial deletions of nucleotides in the ITS region were also found in our previous study on Paphiopedilum (Chung and Choi 2012) and in Brassica (Yang et al. 1999). In the latter case, the authors theorized that this phenomenon was due to rapid evolution that removed non-functional sequences (Yang et al. 1999). The 5.8S subunit is relatively uniform in size, in comparison with the sizes of ITS1 and ITS2, in many plants (Baldwin 1993). In our study, the length of 5.8S fragment among the studied cymbidiums was observed to be the same at 165 bp, except in C. faberi (153 bp). Further studies need to be performed to explain this discrepancy.

Fig. 1. ITS PCR products generated from 8 cymbidium species. M, DNA size marker; 1, C. ens; 2, C. mar; 3, C. fab; 4, C. gyo; 5, C.kan; 6, C. for; 7, C. goe; 8, C. ins.

Table 1. A list of analyzed ITS rDNA nucleotide sequences from cymbidiums in this study.

 On the basis of the analysis of the ITS regions, a sequence similarity/divergence matrix that included 1 subtropical cymbidium (C. insigne) and the outgroup orchid was constructed (Table 2). According to the matrix, genetic variability appeared to be high among the samples (Table 2). Sequence similarities ranged from 78.7% between C. gyokuchin and C. kanran to 96.8% between C. kanran and C. ensifolium (Table 2). The outgroup species, P. insigne, showed low sequence similarity with each of the 8 cymbidiums, namely, between 52.1% and 56.3%. It has been reported that Orchidacea is the most hybridized family and includes intraspecific, intrageneric, and intergeneric hybrids (Arditti 1992). Therefore, genetic variation in ITS rDNA sequences in this study appears to be derived from outcrossing practices and genetic variability. This suggests that the data obtained in this study are sufficient to detect and identify species within the genus Cymbidium.

Table 2. Percentage of sequence pair distance calculated using pairwise nucleotide divergence values for ITS rDNA sequences in the studied cymbidiums.

 ITS rDNA sequences in cymbidiums were compared with one another to infer their phylogeny. Then, phylogenetic trees were derived for the 9 selected species (Figs. 2 and 3). These trees indicated that cymbidiums with a preference for temperate zones were distinguished from the subtropical cymbidium (C. insigne), which occupied a solitary position in the tree generated using the UPGMA method (Fig. 2) and an individual cluster with C. faberi in a parsimonious tree obtained using MP analysis (Fig. 3). According to the UPGMA tree, C. faberi was divergent from C. insigne, while 3 clusters were formed by C. forrestii and C. goeringii, C. gyokuchin and C. marginatum, and C. ensifolium and C. kanran. The parsimonious tree showed a similar grouping with the UPGMA tree (Fig. 3), except for C. insigne and C. faberi. The placement of C. insigne in a different group was previously reported on the basis of amplified fragment length polymorphism, RAPD, and/or ITS analysis (Choi et al. 2006; Zhang et al. 2002). On the basis of results of the phylogenetic analysis and sequence similarity, C. ensifolium appeared to be closely related to C. kanran in this study. Huang et al. (2010) used expressed sequence tag-derived simple sequence repeat marker analysis to cluster 103 cultivars from 6 species of cymbidium in a dendrogram. In addition, they showed that C. ensifolium and C. kanran were clustered together and were closely related, which is similar to what was observed in this study. The results of this study also indicated that C. forrestii and C. goeringii were grouped together in both phylogenetic trees. The 2 species exhibit similar characteristics in terms of blooming season and inflorescence number (solitary). Similarly, multi-floral cymbidiums such as C. ensifolium and C. marginatum were grouped together. P. insigne, the outgroup species, was shown to be very divergent from Cymbidium spp. in all cases. This comparison confirmed the heterogeneous nature of the ITS region. The placement of C. gyokuchin with C. marginatum was quite congruent with the phylogeny on the basis of previous RAPD analysis (Choi et al. 2006). According to a subgenus classification by Du Puy and Cribb (1988), the genus Cymbidium has 3 subgroups (Cyperorchis, Cymbidium, and Jensoa). In this study, cymbidiums native to Asian temperate zones were differentiated from C. insigne by differentiated branching in subgenera Jensoa and Cyperorchis.

Fig. 2. Phylogenetic tree topology generated from the UPGMA method by using an alignment of all ITS sequences derived from 8 Cymbidium species and 1 outgroup species. The optimal tree with the sum of branch lengths = 3.56158327 is shown. The evolutionary distances were computed using the maximum likelihood method and are indicated in units of the number of base substitutions per site. The analysis involved 9 nucleotide sequences. All positions containing gaps and missing data were eliminated.

Fig. 3. Maximum parsimony tree topology created using an alignment of all ITS sequences derived from 8 Cymbidium species and 1 outgroup species. The most parsimonious tree with length = 591 is shown. The tree was obtained using Subtree-Pruning-Regrafting algorithm based on 9 nucleotide sequences. All positions containing gaps and missing data were eliminated.

 Conclusively, all the cymbidium species in this study could be differentiated from one another and identified based on their ITS nucleotide sequences. Using this information, phylogenetic relationships among these cymbidiums were evaluated, and each species was placed in a specific group.

 Analysis of 18S rDNA often causes discrepancies with other molecular-based classifications. Compared to 18S, rapidly evolving ITS rDNA is regarded to yield information about relatively recent divergence events. Length mutations in the ITS rDNA region also appear to be of potential value to phylogeny reconstruction (Soltis et al. 1999). The phylogenetic relationships of the 8 cymbidium species in this study may be useful in estimating their evolutionary history and the hybridization hypothesis. The ITS rDNA sequence analysis showed that cymbidium species have a very heterogeneous genetic background. The cymbidiums analyzed in this study were morphologically differentiated by their temperature preference for growth, and this grouping was in agreement with previous RAPD analysis (Choi et al. 2006).

 Developing highly reliable and discriminatory methods for identifying species and cultivars has become increasingly important to plant breeders. This study represents a basic approach of using ITS rDNA sequences as molecular markers to infer phylogenetic relationships among cymbidium species. Our results may also be useful in tracing the origins of certain characteristics. However, the discussion of phylogeny may be expanded by comparing these results with existing information on conserved and variable nucleotide sites of rDNA. The study of additional taxa may be necessary to clarify relationships within the Cymbidium genus. The molecular markers generated from ITS rDNA sequences in this study may be useful in additional cymbidium taxonomy studies and in confirming the identification of their species and cultivars.

Acknowledgements

  This work was carried out with the support of “Cooperative Research program for Agriculture Science & Technology Development (Project No. 00823803)” Rural Development Administration, Republic of Korea.